Computational Chemistry: Computers harnessed to optimize combinatorial libraries
“If you’re a chemist at a pharmaceutical company, you could have at your fingertips a computer database of millions of chemical compounds. Your job: find the next anticancer agent, antibiotic, or protease inhibitor among all those virtual molecules. But even with the swiftest automated combinatorial methods to synthesize compounds en masse, there’s no way you could possibly make and test all of them. You need a way to pare down the list. Such a task is no small feat. If you’re like some in the combinatorial business, you’re setting out with only a general idea of what you want—say, a drug to inhibit the action of a certain enzyme involved in a disease. But suppose the enzyme itself hasn’t been well-characterized, so the drug target receptor isn’t known yet. To get the best chance of hitting on a compound that will interact with that as-yet-unknown receptor, it makes sense to get a sampling of as many different types of molecules from the library as possible. What you’re looking for, in combinatorial argot, is ‘diversity.’”
-Elizabeth K. Wilson
Neurons growing in a cell culture
These time lapse animations use phase contrast microscopy to show neural stem cells in a nutrient medium for 4 hours. They reveal the dynamic growth and recycling of dendrites and synapses as neurons establish relationships with each other. The social behavior of these cells creates the incredible properties of the mind and brain.
Credit: University of Victoria Medical Sciences
Your brain is doing this RIGHT NOW. Re-wiring as you remember something or learn something, constantly changing.
I’ve written a piece for the State. It’s an attempt to sketch one area where the affordances of wetware computation might (one day) compliment advanced algorithm ecosystems (and the societal effects that result from those computational ecosystems)
There is a great deal to admire about Richard Pelling’s Centre for PostNatural History. Its central objective is exhibiting genetically modified organisms. It’s the framing that I admire most. Pellin posits a post-natural organisms cultural history as a parallel branch of evolution. The CPNH explores artificial selection as a cultural object, and that’s good news IMHO.
On the website 5 PNOs (PostNatural Organisms) are catalogued in curiosity cabinet style: E. coli x1776, Transgenic American Chestnut Tree, BioSteel™ Goat, Triploidy Atlantic Salmon and Sterile Male Screwworm. That curating format carries over to the Transgenic Organisms of New York State exhibition and Strategies in Genetic Copy Prevention exhibition.
Agrobacterium is a genus of Gram-negative bacteria that uses horizontal gene transfer to cause tumors in plants. Agrobacterium is well known for its ability to transfer DNA between itself and plants, and for this reason it has become an important tool for genetic engineering.
A common transformation protocol for Arabidopsis is the floral-dip method: the flowers are dipped in an Agrobacterium culture, and the bacterium transforms the germline cells that make the female gametes. A modified Ti or Ri plasmid can be used. The plasmid is ‘disarmed’ by deletion of the tumor inducing genes; the only essential parts of the T-DNA are its two small (25 base pair) border repeats, at least one of which is needed for plant transformation
The “Merrick” is a digital file infected with the human “Elephantiasis virus” and then converted into a tangible product by using a 3D printer
An interesting conceit. I imagine that the eventual intertwining of viruses, malware and rapid fabricated crapjects won’t be quite as literal and blunt as this provocation (I would be more appreciative of this work if the virus file was also exhibited as part of the artwork).
However the work does fit within a genre of works I’m classifying as biodigital transmission: works where the intermingling of digital and biological logics are explored
The ‘Krebs Faraday Collaboration’ project combines the biological process of creating usable energy in biological life, described by Hans Krebs, and Michael Faraday’s concept of electromagnetic induction. Combining these using synthetic biology could potentially allow life to live on the electrical grid. It envisions the production of synthetic organisms within private spaces – not as products of industrial manufacturing lines.
I like Studio NAND and their work, and I enjoy this work for the implied proximity between consumer available rapid fabrication tools and synthetic biology. However, as I argue here (link to a blog post) I find it unlikely that are interaction with biotechnology will be expressive - its far more likely to be a black boxing of wetware that Apple would be envious of
Hybridization chain reaction (HCR), in which stable DNA monomers self-assemble suggests that nanotechnology and synthetic biology together seem poised to constitute the most transformative development of the 21st century
Enter RNAiFOLD:
Given a target RNA secondary structure, we determine an RNA sequence which folds into the target structure; i.e. whose minimum free energy structure is the target structure. Our approach represents a step forward in RNA design — we produce the first complete RNA inverse folding approach which allows for the specification of a wide range of design constraints
E.G.
The MFE hybridization of the sequences 5’-GGGGGAACCCCGGGGGGGGG-3’ and 5’-CCCCCCCCCC-3’, represented by concatenated sequences with separating ampersand:
‘GGGGGAACCCCGGGGGGGGG&CCCCCCCCCC’, is
(((….))).(((((((((&))))))))).
corresponding to the hybridization
5’-GGGGGAACCCCGGGGGGGGG-3’
(((….))).|||||||||
3’-CCCCCCCCCC-5’
Genetically engineering plants
